|
Thermo Fisher
taqman fam (6-carboxyfluorescein)-mgb (minor groove binder) exon-spanning probes Taqman Fam (6 Carboxyfluorescein) Mgb (Minor Groove Binder) Exon Spanning Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/taqman fam (6-carboxyfluorescein)-mgb (minor groove binder) exon-spanning probes/product/Thermo Fisher Average 90 stars, based on 1 article reviews
taqman fam (6-carboxyfluorescein)-mgb (minor groove binder) exon-spanning probes - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Integrated DNA Technologies
qpcr assay Qpcr Assay, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/qpcr assay/product/Integrated DNA Technologies Average 97 stars, based on 1 article reviews
qpcr assay - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
|
Thermo Fisher
a predesigned exon–exon spanning taqman primer assay for ir A Predesigned Exon–Exon Spanning Taqman Primer Assay For Ir, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/a predesigned exon–exon spanning taqman primer assay for ir/product/Thermo Fisher Average 90 stars, based on 1 article reviews
a predesigned exon–exon spanning taqman primer assay for ir - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Millipore
kicqstart™ primers spanning exons 4–5 Kicqstart™ Primers Spanning Exons 4–5, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/kicqstart™ primers spanning exons 4–5/product/Millipore Average 90 stars, based on 1 article reviews
kicqstart™ primers spanning exons 4–5 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Danaher Inc
primer quest Primer Quest, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer quest/product/Danaher Inc Average 86 stars, based on 1 article reviews
primer quest - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
taqman gene-expression assay Taqman Gene Expression Assay, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/taqman gene-expression assay/product/Thermo Fisher Average 90 stars, based on 1 article reviews
taqman gene-expression assay - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Qiagen
predesigned exon spanning primers Predesigned Exon Spanning Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/predesigned exon spanning primers/product/Qiagen Average 90 stars, based on 1 article reviews
predesigned exon spanning primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp il6 mm00446190 m1 ![]() Gene Exp Il6 Mm00446190 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp il6 mm00446190 m1/product/Thermo Fisher Average 99 stars, based on 1 article reviews
gene exp il6 mm00446190 m1 - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
primer pairs forward 5′atgtataaatgcccttctccaggaa reverse 5′gcaggttcactcacagcagag ![]() Primer Pairs Forward 5′Atgtataaatgcccttctccaggaa Reverse 5′Gcaggttcactcacagcagag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer pairs forward 5′atgtataaatgcccttctccaggaa reverse 5′gcaggttcactcacagcagag/product/Thermo Fisher Average 90 stars, based on 1 article reviews
primer pairs forward 5′atgtataaatgcccttctccaggaa reverse 5′gcaggttcactcacagcagag - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
taqman pcr ![]() Taqman Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/taqman pcr/product/Thermo Fisher Average 90 stars, based on 1 article reviews
taqman pcr - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
viia 7 ![]() Viia 7, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/viia 7/product/Thermo Fisher Average 86 stars, based on 1 article reviews
viia 7 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
sds2.1 sequence detector software ![]() Sds2.1 Sequence Detector Software, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sds2.1 sequence detector software/product/Thermo Fisher Average 90 stars, based on 1 article reviews
sds2.1 sequence detector software - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of Biomolecular Techniques : JBT
Article Title: RNA Purity, Real-Time PCR Sensitivity, and Colon Segment Influence mRNA Relative Expression in Murine Dextran Sodium Sulfate Experimental Colitis
doi: 10.7171/jbt.18-2903-001
Figure Lengend Snippet: qRT-PCR curves for β-actin, Eef2, and IL-6 using the 1-step protocol. Real-time fluorescence using 1:10-fold dilutions starting at 200 ng total RNA from colon run in triplicate using primers/probe for β-actin (A), Eef2 (B), and IL-6 (C). B) The standard curves generated from the Ct values of each of the dilutions and the equation of the line of best fit for β-actin (D), Eef2 (E), and IL-6 (F).
Article Snippet: For both assays, a Taqman gene-expression assay was performed using commercially available, predesigned primers and probes (
Techniques: Quantitative RT-PCR, Fluorescence, Generated
Journal: Journal of Biomolecular Techniques : JBT
Article Title: RNA Purity, Real-Time PCR Sensitivity, and Colon Segment Influence mRNA Relative Expression in Murine Dextran Sodium Sulfate Experimental Colitis
doi: 10.7171/jbt.18-2903-001
Figure Lengend Snippet: Variability of the proinflammatory cytokine IL-6 relative expression in different colon segments. mRNA relative expression of IL-6 in the 3 segments of the colon, proximal (A, D), middle (B, E), and distal (C, F). qRT-PCR was performed by the 1-step protocol, and data are expressed as the relative expression calculated using the Pfaffl method16 and β-actin (A–C) or Eef2 (D–F) as reference genes. Results are expressed as means ± sd; n = 5 mice per group. Mann-Whitney, *P < 0.05, **P < 0.01.
Article Snippet: For both assays, a Taqman gene-expression assay was performed using commercially available, predesigned primers and probes (
Techniques: Expressing, Quantitative RT-PCR, MANN-WHITNEY